lunes, 7 de abril de 2014

Práctica 10. Análisis de estudios genéticos

Publicado por Ciudad Universitaria Virtual de San Isidoro

La genética es la ciencia que estudia la herencia biológica transmitida de generación en generación y  la genómica es el conjunto de ciencias y técnicas dedicadas al estudio integral del funcionamiento, el contenido, la evolución y el origen de los genomas. Ambas.proporcionan una gran cantidad de datos valiosos desde el punto de vista evolutivo. Los datos genéticos y genómicos están desempeñando un papel cada vez más importante en los debates de antropología biológica, no sólo en los temas de la evolución humana. Esta práctica de laboratorio nos ayudará a conocer algunas de las maneras en que se usan los datos genéticos para entender nuestro pasado evolutivo.


1. Secuenciación de ADN

La secuenciación de ADN es un conjunto de métodos y técnicas bioquímicas cuya finalidad es la determinación del orden de los nucleótidos (A, C, G y T) en un oligonucleótido de ADN.

Secuenciación de ADN

La evolución es un cambio heredable en una población a través del tiempo. A partir de los datos genéticos podemos saber más de los cambios evolutivos en nuestro pasado. Existen fuerzas evolutivas específicas. La mutación crea nueva variación de manera aleatoria, mientras que la deriva genética conduce a la pérdida de variación como una función del tamaño de la población.

También podemos conocer más sobre ancestros comunes. La variación dentro de los seres humanos hoy en día proviene de una variación común en el pasado.

Trabajando hacia atrás, por lo tanto, podemos tratar de descifrar algún grado de la historia de una población y de los eventos evolutivos que han dado forma al ver el modelo actual de la variación genética.

Los dos esquemas siguientes muestran un segmento de ADN:

Secuencias de ADN
Teniendo en cuenta lo anterior, ¿cuál de los segmentos de los posibles ancestros es muy probable que sea el ancestro común de los tres que comparten un ancestro común? Razonar la respuesta.


2. Diversidad de nuecleótidos

Ahora imaginemos, que estamos viendo las bases de nucleótidos que componen una cadena de ADN. Lo siguiente serían cuatro segmentos homólogos de ADN:

1 - AATAGCGGGCCATAGCCGGG

2 - AAAAGGGGGTCATAGCCGGG

3 - AATAGGGGGCCTTAGCCGGG

4 - AATTGCGGGCCATACCCGGG

Una medida básica de la diversidad genética (es decir, la variación) es la diversidad de nucleótidos. Este es el número promedio de las diferencias entre las dos hebras de ADN homóloga. Para calcular la diversidad de nucleótidos desea determinar cuántos existen diferencias por pares, y dividir por la cantidad que son teóricamente posibles. Aquí hay un ejemplo básico:

A - ATAGG

B - ACAGG

C - ATAGC

En este caso, tenemos tres personas, lo que significa que tenemos tres posibles comparaciones por parejas (AB, AC, BC).

El número de comparaciones por parejas posibles es igual a n (n-1) / 2 (donde n = número total de individuos). Además, estamos ante un segmento de 5 pares de bases. Así que el número máximo de posibles diferencias por pares es:

3 (comparaciones por pares) x 5 (longitud de la secuencia) = 15

El número total de las diferencias observadas es:

Entre A y B = 1, entre A y C = 1, y entre B y C = 2. Total = 4

 4 (pares de bases (2 entre A / B y B / C, y 5 entre A / C y B / C). Así, en este ejemplo, la diversidad de nucleótidos es 4/15, o 0,267. En otras palabras, en este (extremadamente) la comparación limitada, sobre 26-27% de pares de bases difieren individuo a individuo lado a otro, en promedio.

¿Cuál es la diversidad de nucleótidos para el ejemplo anterior (n = 4, pares de bases = 20).?


3. Diversidad genética y número de generaciones

Una diversidad de nucleótidos superior significa una mayor variación genética. La variación genética es el resultado de las fuerzas de la evolución: la deriva genética, el flujo de genes, la mutación y la selección natural.

En la acumulación de la variación genética, si la variación es neutral, y no está sujeta a la selección natural, la tasa global de la mutación es una variable crítica. La noción de "reloj molecular" nos dice que si sabemos cómo la variación rápida se está acumulando (es decir, la tasa de mutación), y sabemos lo variable que es un conjunto de ADN, entonces se puede estimar la cantidad de tiempo que habría tomado para generar la variación observada. En otras palabras, se puede estimar el tiempo que en el pasado la muestra dada probablemente compartió un antepasado común.

Consideremos de nuevo las secuencias anteriores de ADN:

1 - AATAGCGGGCCATAGCCGGG

2 - AAAAGGGGGTCATAGCCGGG

3 - AATAGGGGGCCTTAGCCGGG

4 - AATTGCGGGCCATACCCGGG

Una secuencia ancestral posible podría tener este aspecto:

A - AATAGCGGGCCATAGCCGGG

Para pasar de esta secuencia ancestral (A) a las cuatro anteriores (1,2,3,4) se requieren 7 cambios evolutivos (cuéntense).

En cada generación, cada par de bases tiene la probabilidad de experimentar de 1/10000. De esta manera, la tasa global de la mutación es igual a la tasa de mutación por pares de bases, multiplicada por el número de pares de bases de que se trate, pero también hay que recordar que cada individuo actúa de forma independiente, por lo que el número total de nuevas mutaciones producidas cada generación es igual a la tasa de mutación por pares de bases multiplicada por el número de pares de bases multiplicada por el número de individuos.

Si la probabilidad de que cualquier par de bases determinado que experimente una mutación de una generación a la siguiente es de 1 en 10 mil, ¿cuántas generaciones habrán de pasar para generar la diversidad genética en esta muestra?


4. Filogenia de Homo sapiens

El ADN mitocondrial o genoma mitocondrial (ADNmt) es el material genético de las mitocondrias, los orgánulos que generan energía para la célula, desciende de genomas circulares pertenecientes a bacterias, que fueron englobadas por un antiguo ancestro de las células eucarióticas. Se considera que el ADN mitocondrial humano se hereda sólo por vía materna.

La secuencia de ADN mitocondrial ancestral común para todos los seres humanos se remonta aproximadamente a unos 200.000 años atrás. Por otra parte, la población original de ADNmt humano era africano. Todos los seres humanos están igualmente relacionados entre sí.

Para entender por completo la historia genética completa de nuestra especie, tenemos que conocer no sólo una pequeña parte del genoma, sino más bien todo, o al menos una muestra grande y representativa. Esto significa conocer los 3,5 mil millones de pares de bases del material genético que se hallan en el núcleo de nuestras células.

En la década de 1990, los estudios genéticos y genómicos humanos mostraron una mayor variación en las poblaciones africanas. Sin embargo, algunos loci genéticos mostraron una historia diferente. Algunos sitios genéticos tuvo su mayor variación en las poblaciones no africanas y mostraron una mayor cantidad de variación de lo que cabría esperar en 200.000 años.

Si hubo un evento de especiación hace 200.000 años que dio origen al Homo sapiens, la evidencia de esto estaría preservada en todos los loci genéticos. ¿Cómo se puede explicar un exceso de variación genética con un origen más antiguo que lo que indicaría el modelo de especiación africana hace 200.000 años?

Una posibilidad sería que la población de Homo sapiens original no era una sola población, sino más bien un conjunto de poblaciones. Recordemos que la variación entre las poblaciones es una de las fuentes fundamentales de variación en una especie biológica. Si la especiación del Homo sapiens se dio por múltiples poblaciones, estas poblaciones habrían conservado mayor variación ancestral de lo que de otro modo se podría esperar, lo que explica las observaciones de muchas variantes genéticas antiguas.

Una forma de probar directamente la idea de que los seres humanos se cruzaron con las poblaciones arcaicas de Homo sería buscar directamente en el ADN extraído de esas poblaciones (llamado ADN "antiguo"). Los avances en la tecnología de secuenciación genética comenzaron a hacer esto posible en la década de 2000.

Los primeros estudios de ADN antiguo se centraron en el ADNmt, por las mismas razones que los primeros estudios de ADN humano se centraron en el ADNmt, por su facilidad de obtención. Estos estudios, basados ​​en ADN antiguo extraído de los neandertales, mostraron que el ADNmt neandertal era más divergente de los seres humanos que viven, en promedio, que las poblaciones humanas más divergentes. En otras palabras, los neandertales parecen ser más diferentes de los seres humanos actuales que las dos poblaciones humanas más diferentes que existan. Este resultado parece apoyar la tesis de que los neandertales se separaron de los seres humanos actuales en algún momento antes de nuestro origen. ¿Qué árbol filogenético representaría esta relación?

Hay que tener en cuenta que el ADNmt es apenas un solo locus genético, y no necesariamente una ventana a toda la historia de una especie, y el ADN nuclear no se hereda de forma fiable. El ADN nuclear y el ADN mitocondrial se heredan a través de diferentes procesos incompatibles entre sí.

Los neandertales y los homínidos de Denisova deberían mostrar más similitud con los europeos que otras poblaciones. Si los neandertales y los homínidos de Denisova eran una especie separada, deben ser igualmente relacionados con diferentes poblaciones humanas que viven.

Las recientes investigaciones del ADN de la Sima de los Huesos muestran desconcertantemente que el ADNmt de Atapuerca es más cercana a los denisovanos que a los nendertales. Una posibilidad es que el ADN mitocondrial no nos está contando una historia muy completa. Los denisovanos y los ejemplares de Atapuerca podrían estar más estrechamente relacionados en términos de ADNmt, pero los neandertales y los ejemplares de Atapuerca aún podrían estar más estrechamente relacionados en cuanto al ADN nuclear.

El patrón de la extinción de la población, la sustitución y el flujo de genes en la tarde del Pleistoceno fue compleja. Las poblaciones emigraron a través de toda Eurasia en un sentido y otro, y el movimiento de los genes y el movimiento de personas están estrechamente vinculados. Los denisovanos se extinguirían antes del origen de los neandertales.

Discutir, en base a lo anterior, el siguiente árbol filogenético de Homo, en el que la línea de cruce correspondería a los denisovanos:


Temas de Paleontología Humana (Paleoantropología)

0 comentarios:

Publicar un comentario en la entrada

Related Posts Plugin for WordPress, Blogger...