Mostrando entradas con la etiqueta Prehistoria. Mostrar todas las entradas
Mostrando entradas con la etiqueta Prehistoria. Mostrar todas las entradas

El comportamiento neandertal


Los primeros hallazgos del hombre de Neandertal, al ser más robustos que los de Homo sapiens, proporcionaron un estereotipo y una imagen primitiva y animal que no se corresponde con la realidad. Era habitual hace tan sólo unas décadas representar a los neandertales con rasgos y posturas simiescas.


Forma de vida y sociedad

El uso del fuego por los neandertales es generalizado en los yacimientos. Además se comprueba en ellos unos asentamientos muy bien estructurados, en los que se distinguen varias áreas, una para dormir, otra de reunión, alrededor del fuego. Presumiblemente cubrían el suelo con pieles de caballo o ciervo a modo de alfombras.

Para algunos especialistas, la división sexual del trabajo empieza en los neandertales. Posiblemente se daría la diferencia que hoy existe en las sociedades de cazadores-recolectores. Los hombres se dedicarían a la caza, la elaboración de herramientas y talla de piedra, la construcción de cabañas, el fuego, o el tratamiento de pieles, y las mujeres y los niños, a la recolección de vegetales, acopio de madera y agua y el mantenimiento de los hogares. Hay que alejar de esta concepción social los estereotipos actuales machismo-feminismo, ya que la repartición de tareas no sería exclusivamente por el sexo, sino por la aptitud para las mismas, ya que en un entorno de difícil supervivencia, era importante que cada uno se dedicase a lo que mejor supiera hacer y es muy posible, que hubiera algunos hombres dedicados a la recolección o mujeres dedicadas a la caza o talla de piedras.

La ayuda de la sociedad a los individuos es muy evidente en los neandertales, ya que muchos de ellos poseen heridas y patologías óseas graves, que les hubieran ocasionado la muerte, de no haber sido cuidados por sus semejantes. En Shanidar, Irak, aparecieron los restos de un individuo con malformaciones óseas ocasionadas por la artritis y con la pérdida de un brazo a causa de un grave accidente, y que sobrevivió muchos años.

En lo que respecta a su alimentación, tradicionalmente se les ha situado en zonas glaciales, con grandes manadas de mamíferos, siendo excelentes cazadores. Es evidente que cazaban caballos, ciervos, renos, bisontes, y cabras, y aprovechaban sus pieles y tendones. Sin embargo, es cierto que eso se dio en su expansión por Europa y Asia, pero en su lugar de origen, la Península Ibérica, de clima era más templado, hay especialistas que opinan que sólo comerían carne de vez en cuando, como carroñeros oportunistas, siendo a base de vegetales la mayor parte de su dieta. En todo caso, las dos posturas puede ser ciertas y no contradictorias, eran excelentes cazadores, pero también podían ser carroñeros y recolectores.

En la caza eran sumamente ingeniosos. Cazaban animales extraordinariamente grandes y fuertes, como rinocerontes, bisontes y osos cavernarios, por lo que hacían uso de avanzadas técnicas de cacería y métodos efectivos de comunicación.


El comportamiento simbólico

El comportamiento simbólico es el tipo de pensamiento que posee la capacidad para crear y utilizar elementos simbólicos, como pueden ser los adornos personales, sistemas de  anotación, el uso de pigmentos, el enterramiento de sus difuntos, el desarrollo de una tecnología compleja, el lenguaje, la creación del arte y de la música. Uno de los elementos que supone mayo abstracción es el lenguaje hablado, comportamiento simbólico por excelencia. Generalmente se asocia el uso de la lengua con el origen del resto de estas capacidades.

El comportamiento no simbólico es el comportamiento destinado a la supervivencia y procreación de la especie. Por contra, el comportamiento simbólico puede ir contra lo biológicamente deseable, incluso contradiciendo la propia naturaleza y los impulsos biológicos, como las prácticas rituales nocivas generadoras de enfermedades, claramente desventajosas desde un punto de vista biológico, pero que por el hecho de ser significativamente simbólicas son realizadas.

El lenguaje plenamente elaborado es posible que existiese entre los neandertales. Este es un asunto polémico en el mundo científico. Durante mucho tiempo se pensó que los neandertales carecían de la capacidad cognitiva necesaria y la estructura vocal para emitir la voz, comunicándose a través de gruñidos. Pero los últimos descubrimientos paleontológicos y los avances en Genética están cambiando esta concepción. Hay especialistas que sostienen que el habla y el lenguaje son mucho más antiguos de lo que se pensaba.

Los neandertales adornaban sus cuerpos con objetos ornamentales como collares hechos con conchas y fósiles de animales marinos. Posiblemente también usaran pigmentos y plumas como adorno personal.

Los neandertales posiblemente adornaran sus cuerpos con pigmentos
Los neandertales posiblemente adornaran sus cuerpos con pigmentos

Los enterramientos y los ritos fúnebres

Otra evidencia que poseemos sobre los neandertales es la conciencia social, el respeto a los muertos y posiblemente la creencia en un más allá, que nos ha llegado a través de sus enterramientos. En ellos, se han hecho con cuidado y tiempo, empleando pieles y colmillos de carnívoros, pigmentos minerales y plumas para ornamento. Por otra parte se han encontrado individuos enterrados y otros que no. Esto puede obedecer a varias y distintas circunstancias, desde la importancia social del individuo, el aprecio que generaba, la imposibilidad de realizar un adecuado enterramiento o simplemente morir desaparecido o en extrañas circunstancias.

En los enterramientos de La Chapelle-Aux-Saints y La Ferrassie en Francia hay evidencia de la separación de los cráneos tras la inhumación, posiblemente para ser preservado aparte o cuidado por los parientes, lo que evidencia un alto nivel de sensibilidad o una posible existencia de ritos fúnebres.

Otra tesis reforzadora del arraigo del pensamiento simbólico en los neandertales es la elecada presencia de cráneos de úrsidos en sus hogares, esta práctica posiblemente estaría relacionada con algún tipo de rito o culto al oso cavernario.


El arte en los neandertales

La definición de arte es compleja y si ya es difícil de por sí, no digamos en cuanto al arte del Paleolítico. El arte es una manifestación del comportamiento simbólico que consiste en la creación de cualquier manifestación artística, ya sea imagen, sonido, tallo o cualquier otra, que lleva un componente comunicativo, que para los elementos de la sociedad que lo producen, cumple una función estética, mística y de cohesión social.

El arte es una capacidad específicamente humana, exclusiva del género Homo, pero no sabemos si exclusiva o no de nuestra especie Homo sapiens. Su origen continúa siendo una incógnita.

Otro aspecto, es la capacidad artística, pues esta requiere un aprendizaje. Hay autores que sostienen que el neandertal tenía esa capacidad, pero aún no la había desarrollado.

Tradicionalmente se ha negado la posibilidad de toda tipo de manifestación artística a los humanos del Paleolítico Inferior, como Homo erectus, Homo ergaster y Homo heidelbergensis. Sin embargo pudieran haber tenido cierto criterio estético, al haber realizado coleccionismo de piedras raras y de cristales. En yacimientos de Homo heidelbergensis se han encontrado huesos de elefante decorados con rayas grabadas
paralelas y un fragmento óseo con incisiones en forma de semicírculos concéntricos. Es por lo que al Homo heidelbergensis se le atribuye el inicio del pensamiento simbólico, que no arte.

La producción artística de los neandertales constituye uno de los más interesantes debates en la Paleoantropología y Prehistoria. Existen actualmente tres posturas, una que niega las capacidades artísticas del neandertal, otra que considera que sí existió arte durante el Musteriense, y la última defiende que sólo los neandertales tardíos del Chatelperronense produjeron arte.

Muy posiblemente los neandertales realizaran manifestaciones artísticas sobre materiales perecederos como pieles, cestería, madera, pero el registro arqueológico no puede recogerlas, sí otro tipo de materiales más resistentes.

Una de las piezas más interesantes del Musteriense es la estatuilla de Berekhat Ram o Berejat Ram (Israel), que data de hace 233.000 años a. de C., con una modificación humana deliberada mediante abrasión y acanalando, pero no se rechazan la hipótesis de que sirviera sólo a propósitos utilitarios.

Venus de Berejat Ram, ¿arte o herramienta?
Venus de Berejat Ram, ¿arte o herramienta?

También nos han llegado trazos abstractos, marcas paralelas, rayas y zigzag en huesos, y muchas de ellas no sabemos si fueron hechas por humanos modernos o neandertales. Algunos especialistas las toman como simples marcas dejadas por las herramientas durante el descarnado o alimentación, mordeduras de carnívoros o roedores, etc. La tesis predominante es que no son obras de arte. Algunos especialistas las catalogan como muestra de pensamiento simbólico en lo que sería una especie de proto arte.



Paleontología Humana (Paleoantropología)
Leer más

Homo heidelbergensis


Homo heidelbergensis es una especie extinta del género Homo. Surgió hace unos 600.000 años y se extinguió hace 250.000 años, a mediados del Pleistoceno.

Su nombre científico deriva del descubrimiento de sus primeros fósiles en 1907, la llamada mandíbula de Mauer, descubierta en esta localidad próxima a la ciudad de Heidelberg, Alemania, por un minero, datada de hace 600.000 años. Se han encontrado restos en Alemania, Francia y en España. Su anatomía ha sido descrita en gran parte por los restos encontrados en el yacimiento de la Sima de los Huesos en Atapuerca, España.


Características anatómicas

Eran individuos altos y muy fuertes. Medían unos 1,80 m de estatura y podían llegar a 105 kg de peso, con grandes cráneos que median 1350 cm³, con mandíbulas salientes y gran abertura nasal.

Los Homo heidelbergensis, preneandertales, mostraban una gran corpulencia física, ya que su talla era de 1,75-1,80 metros y cerca de 100 kg de peso, como media masculina. Las mandíbulas también poseían una gran fuerza y robustez a causa del desgaste que sufrían por la alimentación de carne cruda. Estas características morfológicas que van a dar origen al neandertal se inician aproximadamente hace medio millón de años.

El cráneo de Homo heidelbergensis es más redondeado que el de Homo erectus u Homo ergaster y la cara es más plana, aunque posee rasgos primitivos como los arcos supraorbitales.

Réplica de la mandíbula de Mauer
Réplica de la Mandíbula de Mauer

Expansión y hallazgos de Homo heidelbergensis

Posteriormente a la aparición de los primeros restos en Mauer, Alemania, se encontraron en la cueva llamada Caune de l'Arago, en Francia, fragmentos de restos fragmentarios de una docena de individuos. Uno de ellos, el más completo, con la cara y parte de la caja craneana de un individuo conocido como Hombre de Tautavel, data de cerca de hace 450.000 años y tiene gran parecido al cráneo del Hombre de Petralona, encontrado en una cueva en Grecia, que también se ha atribuído a Homo heidelbergensis.

Otros lugares donde se han hallado fósiles atribuidos a esta especie, son Steinheim, Alemania; Swascombe, Inglaterra, y la Sima de los Huesos en la Sierra de Atapuerca, España, donde se han encontrado 5.000 fósiles pertenecientes a unos 30 individuos, de hace 400.000 años, restos que están muy bien conservados.

En China se han encontrado fósiles que concuerdan con este grupo, en el sitio de Dali, un cráneo de hace 280.000 años, y un esqueleto en Jinniushan.

También se han encontrado fósiles relacionados con esta especie en África en los sitios de Bodo, al noreste de Etiopía; en Kabwe, Zambia, y en el Lago Ndutu, Tanzania. No existe consenso en la comunidad científica sobre estos fósiles africanos. Para algunos pertenecen a la especie Homo heidelbergensis. Otros piensan que los fósiles europeos y africanos pertenecen a dos especies diferentes, y las poblaciones africanas, serían otra especie clasificadas como Homo rhodesiensis, que sería un Homo sapiens arcaico, que evolucionaría hacia el Homo sapiens, mientras Homo heidelbergensis sólo correspondería a los fósiles europeos, que se muestra más claramente en la línea evolutiva hacia el hombre de Neandertal.

Tampoco hay unanimidad sobre la clasificación del hombre de Petralona (Grecia), que podría ser un Homo heidelbergensis tardío o más bien un Homo rhodesiensis u otro Homo sapiens arcaico que llegó a Europa desde África, a través de las costas del Mediterráneo.

Todo esto indica, independientemente de la atribución dudosa de algunos restos, una gran expansión geográfica de Homo heidelbergensis, siendo los primeros Homo que llegaron a las estepas del centro y norte de Eurasia, expansión que ya se había iniciado con su ancestro Homo antecessor.


Lugar en la evolución

El detallado análisis morfológico de los fósiles atribuidos a esta especie ha permitido proponer dos líneas evolutivas. La primera estaría formada por los restos de la mandíbula de Mauer, los fósiles de Arago y Petralona, es un grupo cosmopolita que incluye los cráneos de Kabwe y Bodo en África y Dalí y Jinniushan en China. La segunda, incluiría los fósiles de Steinheim, Reilingen y la Sima de los Huesos en Atapuerca y estaría más relacionado con el hombre de Neandertal, ya que presenta  morfologías muy neandertales, que haría la posibilidad de que a partir de una población como esta, por un cuello de botella, en algún refugio climático, surgiera la especie Homo neanderthalensis.

La secuenciación de ADN mitocondrial de un fémur procedente de la Sima de Los Huesos mostró resultados sorprendente, al poseer mayor relación con los fósiles siberianos del Homínido de Denísova que con el ADN neandertal, lo que abre paso a la hipótesis de una compleja relación entre las distintas especies de Homo en Eurasia.


Comportamiento y forma de vida

Homo heidelbergensis es la primera especie humana en la que se han detectado indicios de una mentalidad simbólica. El aparato fonador es cercano al de Homo sapiens, por ello es posible que el lenguaje, entendido de una manera quizás diferente a la actual, ya estaba presente en esta especie. Tomaron conciencia de la muerte y dieron quizá los primeros balbuceos en el arte. Podían haber sido los primeros creadores de lo que hoy conocemos como cultura.

Si Homo erectus era probablemente cleptoparásito, robando presas a los animales predadores y complementando su dieta con alimentos vegetales, en Homo heidelbergensis predomina la dieta carnívora con evidencias de caza. El motivo de una mayor actividad cazadora se debería a las condiciones ecológicas del territorio que colonizaron, ya que Europa era fría y durante seis meses existían muchos menos recursos alimenticios vegetales que en África. A través del carroñeo y el cleptoparasitismo no hubieran conseguido suficientes nutrientes. La caza contribuyó a la aparición de conductas sociales dedicadas a la caza, como grupos organizados para perseguirlos a llevarlos a trampas naturalas, como precipicios y pantanos.

Los utensilios asociados con los fósiles consisten básicamente en piedras de corte y herramientas de lascas como puntas y raspadores de madera, hueso y asta, siendo los iniciadores de esta técnica. en su tecnología se encuentra el bifaz, también llamado hacha de mano, de grandes dimensiones y está tallado por las dos caras, con utilidad muy diversa. Hace 400 000 años ya se usarían rudimentarias lanzas de madera. También es muy probable que en esta época el fuego fuese utilizado, ya que hay evidencias de hogueras.

Reconstrucción de Homo heidelbergensis
Reconstrucción de Homo heidelbergensis

En esta especie, se puede empezar a hablar de pequeños grupos con cohesión social, ya que se han encontrado restos de mandíbulas totalmente desdentadas, que indicarían que el anciano, tras perder su dentadura, seguiría viviendo ayudado por sus congéneres. Esto se traduce en una conducta diferencial a la hora del tratamiento de sus cadáveres, a los que se darían, por decirlo así, ciertas honras o rituales fúnebres. Hay otro aspecto interesante, en cuanto a las dentaduras de Homo heidelbergensis. Los molares y la dentadura definitiva les aparecían entre los 5 y 6 años tras ser paridos. En un chimpancé esto ocurre hacia los 3 años. Considerando que un individuo no puede alimentarse por sí mismo hasta tener bien desarrollada su dentición, esto querría decir que en Homo heidelbergensis se daría un prolongado cuidado de las crías con fuertes relaciones afectivas entre los individuos, cohesionando al grupo social y capacitándoles para, entre otras cosas, desarrollar eficaces estrategias de caza y de supervivencia en general.

En Terra Amata, Francia, se han encontrado restos de refugios construidos en la época de Homo heidelbergensis. Estos refugios tenían una forma ovalada, de unos ocho metros de largo y seis de ancho, encontrándose dentro restos de ceniza.



Leer más

Homo antecessor


Homo antecessor es una especie extinta perteneciente del género Homo. Se le considera la especie de homínidos más antigua de Europa y probable ancestro de la línea que llevaría Homo heidelbergensis y luego más tarde a Homo neanderthalensis. Vivió hace unos 900.000 años, en el Pleistoceno temprano.


Definición de la especie

La definición de esta especie se realiza a partir de los más de ochenta restos hallados desde 1994 en el nivel TD6 del yacimiento de la Gran Dolina, en la Sierra de Atapuerca, en España. Según mediciones paleomagnéticas, datan de hace al menos 900.000 años.

Su dentición tiene rasgos muy primitivos, que los relacionaría con los los homínidos africanos del Pleistoceno Inferior. Una mandíbula muy bien conservada, del yacimiento de la Gran Dolina, de una mujer Homo antecessor, de unos 15-16 años, posee unas claras similitudes con las del Hombre de Pekín, de la especie Homo erectus, lo que sugiere un origen asiático de Homo antecessor. Sin embargo, los patrones de desarrollo y salida de los dientes son prácticamente idénticos a los de las poblaciones modernas.

En la actualidad, la validez de la denominación como Homo antecessor, como especie diferente, es defendida por sus descubridores y otros expertos, considerando que Homo antecessor precede a Homo heidelbergensis y por tanto es también antepasado de Homo neanderthalensis. Pero una parte de la comunidad científica la considera una denominación no específica, para referirse a los restos encontrados en Atapuerca, que ellos asignarían a la especie Homo heidelbergensis o bien, la considerarían una variedad de Homo erectus u Homo ergaster.

En 1994 se descubrió en Ceprano (Italia) la parte superior del cráneo de una especie perteneciente al género Homo. Sus caracteres eran primitivos, tenía unos 800.000-900.000 años de antigüedad. Se le bautizó como el Hombre de Ceprano, y en 2003 se propuso el nombre de científico de Homo cepranensis. Para algunos autores, la especie sería Homo antecessor, pero la comparación no es posible, ya que los restos corresponden a distintas partes anatómicas o a individuos de edades diferentes, ambos conjuntos poseen en común el presentar rasgos intermedios entre las poblaciones de Homo primitivas de África y las más recientes de Homo heidelbergensis de Europa. La datación absoluta como la industria lítica de Ceprano son similares a las obtenidas en la Gran Dolina. Si realmente estos restos corresponden a la misma especie de Homo, la denominación Homo antecessor tiene prioridad nomenclatorial, ya que fue propuesta antes.

En 2007 fueron hallados, en la Sima del Elefante, yacimiento a unos 200 metros de la Gran Dolina, unos restos que eran parte de una mandíbula de un individuo de unos 20 años y 32 herramientas de tipo olduvayense, datados en 1,2 millones de años de antigüedad, atribuyéndose inicialmente a Homo antecessor. Si a este se le atribuye una edad de 900.000 años, significaría que la presencia de homínidos en Europa habría que retrocederla 300.000 años atrás, o sea, 1,2 millones de años. El estudio detallado de la mandíbula, que presenta unas características en la dentición y en la sínfisis (articulación cartilaginosa que presenta un disco de fibrocartílago entre las superficies articulares) la separan de Homo antecessor y la  aproximan a los Homo más antiguos de África y de Dmanisi (Georgia) pero con algún carácter distinto (como la parte interna de la sínfisis). Por todo ello, se han identificado los restos como Homo sp., pertenecientes al género Homo pero sin determinar la especie. Es probable que pertenezcan a una nueva especie aún por definir, y cuyas relaciones filogenéticas, sin más datos, son aún imprecisas, lo que añade aún más interrogantes a la evolución humana.

En 2010 fue publicado en la revista Nature, un estudio sobre la temprana llegada de Homo a Gran Bretaña, a partir de unas herramientas y unas huellas de pisadas de cincos individuos, uno de ellos adulto, hallados en la playa de Happisburgh, Norfolk. Las icnitas se dataron en 780.000-1.000.000 años y las herramientas en 780.000. Dada la similar edad con los de Atapuerca, todos estos restos se han atribuído a Homo antecessor. Esto le da una nueva faceta, la de hombre pionero.


Yacimiento de la Gran Dolina, en Burgos, España

Yacimiento de la Gran Dolina, en Burgos, España

Características anatómicas

Eran individuos altos y fuertes. La mayoría alcanzarían una altura de entre 160 y 185 centímetros, con un peso de entre 60 y 90 kilogramos.

La morfología facial de Homo antecessor es similar a la de Homo sapiens, aunque de rasgos primitivos, presentaría una cara más moderna que Homo erectus. La capacidad encefálica, estimada a partir de un fragmento incompleto de hueso frontal, indica una cifra superior a los 1000 cm³.

La morfología de la mandíbula recuerda a la de ciertos homínidos muy posteriores, como los de la especie Homo heidelbergensis. El esqueleto postcraneal indicaría más gracilidad en comparación con la mayor robustez del Hombre de Neandertal de la segunda mitad del Pleistoceno Medio.


El canibalismo en Homo antecessor

Todos los estudios realizados por el Centro Nacional de Investigación Humana en Burgos, España, confirman que Homo antecessor era caníbal y además concluyen que que el entorno en el que se desarrollaba Homo antecessor era muy rico en recursos, por lo que el canibalismo no se debía a periodos de hambruna.

Hembra de Homo antecessor practicando el canibalismo
Hembra de Homo antecessor practicando el canibalismo

Este hallazgo fue polémico e impactó en los medios de comunicación. Pero las pruebas eran muy claras: muchos de los huesos de Homo antecessor hallados en sus mismos estratos geológicos tenían las mismas marcas y cortes que los de piezas de caza de otras especies. Y no sólo eso también practicaba el canibalismo con especímenes jóvenes e incluso niños de los grupos rivales.

Todo esto contrasta con los datos de los restos fósiles de que Homo antecessor era completamente protector con los miembros de su propio grupo, que contrasta con que no tenía problemas en atacar, cazar y comerse a los integrantes de tribus enemigas, niños y jóvenes incluidos.

Se han hallado similitudes en ciertos comportamientos del chimpancé. Pero lo que es cierto es que las razones del comportamiento canibal de Homo antecessor las desconocemos por completo y abren un gran interrogante del que aún no tenemos respuesta.



Paleontología Humana (Paleoantropología)
Leer más

Hipótesis metabólica para la altricialidad humana

Los humanos al nacer son sumamente desvalidos
Los humanos al nacer son sumamente desvalidos
Se conoce como altricialidad al estado de inmadurez de las crías de una especie animal en el momento de nacer. Es lo contrario a precocidad, que se produce cuando las crías nacen muy desarrolladas.

La altricialidad exige un período de madurez para alcanzar las características de un individuo adulto y un proceso de aprendizaje, lo que implica en cierta medida. cuidados o vigilancia parental.

La altricialidad se da en especies de mamíferos, como en placentarios, roedores y algunos carnívoros, naciendo en un estado de inmadurez, con los ojos y conductos auditivos cerrados o semicerrados, sin pelo y con severas limitaciones motoras.

Los humanos, al nacer, son seres absolutamente inmaduros y desvalidos. En los primates actuales, ninguna especie es tan vulnerable al nacer como la humana, El tamaño del encéfalo humano, al nacer, es la tercera parte del que tendrá cuando alcance su máximo desarrollo. El momento del nacimiento, los humanos están muy lejos de disponer de plenas facultades neurológicas y cognitivas. El lento desarrollo humano y la gran duración del periodo de cría llevan asociados el emparejamiento estable, la supervivencia prolongada de las abuelas, y el cuidado aloparental de las crías, a cargo de otros miembros del grupo.

Hasta ahora, la hipótesis predominante era la conocida como el dilema obstétrico. La altricialidad se explicaría como resultado de dos presiones selectivas contrapuestas, una que tiende al aumento del tamaño encefálico y otra, la tendente a configurar una pelvis idónea para la locomoción bípeda. La pelvis materna impone severos límites al tamaño de la cabeza del recién nacido, lo que complica de manera notable el parto. En comparación con el canal de parto de otros primates, el de las mujeres es el más estrecho en proporción al tamaño de la cabeza del recién nacido. Todo esto habría supuesto una gestación truncada, que llega a término mucho antes de lo que requeriría un desarrollo encefálico equivalente al de los otros primates,. La razón de este truncamiento sería la imposibilidad de dar a luz a bebés con cabezas de mayor tamaño. Pero esta teoría ha sido puesta en cuestión.

Según la hipótesis del dilema obstétrico, la locomoción bípeda hubiera sido menos eficiente con pelvis más anchas, ya que hubiera resultado energéticamente más costosa. Sin embargo, hay dos factores que parecen negarlo. El primero es que las mujeres tienen pelvis más anchas que los hombres, y entre ambos no se han encontrado diferencias en el gasto energético de la locomoción. El segundo es que los análisis biomecánicos teóricos no indican que la eficiencia en la locomoción tenga por qué ser inferior por tener pelvis más anchas.  Por otro parte, si el recién nacido tuviese un grado de desarrollo equivalente al de un chimpancé (que nacen con un 40% del tamaño de cabeza de un adulto), la cabeza del bebé tendría un diámetro 3 cm mayor; tampoco es una gran diferencia, y en principio, si no hay una disminución en la eficiencia de la locomoción, no hay razón para pensar que no se hubiese producido un aumento suficiente en la apertura del canal del parto femenino para facilitar la salida al exterior de una cabeza con ese diámetro. Todas estas razones ponen en cuestión la hipótesis del dilema obstétrico.

En la hipótesis metabólica, las limitaciones no serían anatómicas, sino de índole metabólica. Un feto en desarrollo consume mucha energía metabólica, ya que además de necesitar los materiales estructurales para construir su organismo, su tasa metabólica es muy alta, como corresponde a unos tejidos muy activos en pleno crecimiento. El encéfalo de un recién nacido humano es mayor que el de cualquier otro primate neonato, tanto en términos absolutos como en relación con el tamaño de la madre, como ocurre con el tamaño corporal. Si lo comparamos con los gorilas, el encéfalo humano sería un 50 % superior y el doble de grande; en este sentido, los bebés humanos superan al resto de primates con gran diferencia. De todo esto se deduce que las gestantes humanas dedican a sus fetos un esfuerzo metabólico sin comparación con cualquier otro mamífero y, en concreto, con cualquier otro primate.

La duración de la gestación y del crecimiento fetal en los mamíferos están condicionados por las limitaciones o restricciones energéticas, tanto de la madre como del feto. Estas limitaciones, en la especie humana serían las que imponen la duración de la gestación y no las sostenidas en la hipótesis del dilema obstétrico. El parto se produciría cuando las demandas metabólicas del desarrollo fetal superan la capacidad de la madre para obtener los recursos energéticos necesarios para poderlas satisfacer.

La tasa metabólica basal mide el valor mínimo de energía necesaria para que las células del cuerpo sigan viviendo. Es decir, el mínimo de energía que gasta el cuerpo en reposo, realizando funciones metabólicas esenciales, como la respiración. En la especie humana la tasa metabólica máxima que se puede mantener a lo largo del tiempo es de 2-2,5 veces la tasa metabólica basal. Niveles de 4-5 veces la tasa metabólica basal, en grandes ciclistas y deportistas de resistencia son valores excepcionales y no se pueden considerar como representativos. Durante el embarazo, la tasa metabólica de la gestante se aproxima a ese límite de 2-2,5 veces la tasa basal y en el sexto mes, la tasa metabólica es el doble de la basal. En los últimos meses de embarazo y primeros de lactancia, no se sobrepasa ese límite, incluso en mujeres que, además de estar embarazadas, realizan un trabajo duro. En el noveno mes se llega a una tasa metabólica que es 2,1 veces la basal, y la prolongación del embarazo requeriría un esfuerzo metabólico imposible para la madre. Por todo ello, los autores de la tesis sostienen que la duración del embarazo y el momento del parto vienen determinados por este condicionante.

Sin embargo, si esta hipótesis es correcta, el parto no debería resultar tan problemático, debería realizarse sin dificultad y sin riesgo para la madre y el bebé. Para esto, existen posibles explicaciones. La primera explicación es que una pelvis grande requiere un tamaño corporal grande y no hay que perder de vista que el tamaño corporal está muy condicionado por factores ecológicos. La segunda posibilidad es que ese agrandamiento de la pelvis supondría inconvenientes en términos de eficiencia locomotora, como la estabilidad o la velocidad. Una tercera posibilidad es que las dificultades en el parto sean un fenómeno relativamente reciente, debido a un consumo energético materno más alto, por cambios en la dieta, por lo que los neonatos han adquirido un tamaño mayor que el que tenían en el pasado, sin dar tiempo evolutivamente a un aumento en la anchura de la pelvis. Y hay una cuarta y última explicación es que la llegada al mundo del recién nacido sea la óptima en cuanto al desarrollo encefálico del neonato y su posterior desarrollo cognitivo y neuromotor.

Finalmente, hay autores que sostienen que las dos hipótesis, la del dilema obstétrico y la metabólica, son ambas ciertas, contribuyendo cada una en cierta medida.



Paleontología Humana (Paleoantropología)
Leer más

Homo ergaster


Homo ergaster es un homínido extinto, propio de África. Se estima que vivió hace 1-1,75 millones de años en África, durante el Pleistoceno medio.

Fue descubierto en 1975 en Koobi Fora (Kenia) a través de dos cráneos que habrían tenido un cerebro de aproximadamente 880 cm³ de tamaño. En Nariokotome, cerca del lago Turkana, en Kenia, fue descubierto el esqueleto completo de un niño de unos 11 años, 1,60 m de estatura y cerebro de 880 cm³, con una antigüedad de 1,6 millones de años, al que se denominó como el niño de Nariokotome.
Cráneo de Homo ergaster
Cráneo de Homo ergaster
La tendencia científica predominante es considerar a Homo ergaster descendiente de Homo habilis y antecesor de Homo erectus. En cambio, para otros especialistas Homo ergaster y Homo habilis son una única especie, debido a su gran parecido anatómico; y en este caso tendría prioridad la denominación como Homo erectus, al ser más antigua.

Homo ergaster tiene un cráneo menos robusto y con toros supraorbitales menos acusados que los Homo erectus asiáticos. La altura y proporción anatómica es semejante a los humanos actuales, al igual que Homo erectus, pero como este tienen una complexión más robusta. Su cerebro tiene un tamaño importante, sobre los 850 cm³. Se ha asociado con importantes cambios culturales. Se les ha asociado, en sus inicios, con la industria lítica olduvayense, para luego pasar a la achelense.

Pudo ser el primer homínido con capacidad para el lenguaje articulado. Sin embargo la estructura de las vértebras cervicales del niño de Nariokotome parecen refutar tal hipótesis, pero podía ser una anomalía.

Es probable que los Homo ergaster pueden haber sido los primeros homínidos en establecer relaciones sociales complejas, facilitadas por un primitivo lenguaje oral articulado. El desarrollo de las áreas corticales prefrontales y frontales del cerebro junto con las del lenguaje podían haber posibilitado relaciones mentales complejas como intuir a que tipo de animal correspondían unas determinadas huellas.

Otra característica singular de Homo ergaster es que fue un gran viajero que salió del continente africano (como quizás pudieran haberlo hecho antes otros homínidos, como Homo habilis) y se expandió por el Viejo Mundo bajo diversos nombres, dependiendo de la zona. Esta expansión trajo consigo variantes morfológicas, que se ha supuesto que en casos de aislamiento prolongado dieron lugar a nuevas especies, pero que según las últimas revisiones, podían ser subespecies.

A consecuencia del descubrimiento de las primeras migraciones del género Homo, se propusieron varias teorías.

La primera de ellas, la Teoría Multiregional, que estuvo en vigor en el siglo XIX y hoy se considera obsoleta, sostenía que Homo erectus (o Homo ergaster), había salido de África hacia Europa y Asia, dando lugar a distintas razas. Fue apoyada por el racismo al sostener la evolución de las razas de forma separada. Fue refutada por los avances en genética, que demostraron que los humanos modernos tienen un origen común hace unos 200.000 años en una zona de África del Este, llevando a cabo una emigración por todo el mundo a través de Oriente Próximo hace unos 100.000 años.

La segunda teoría, de más común aceptación hasta hace muy poco, es la denominada Teoría “Out of Africa” (fuera de África), según la cual, la especie humana actual desplazó a otras especies humanas distintas, adueñándose del planeta.

Algunos investigadores sostienen una tercera teoría, que matiza las anteriores, es la llamada Teoría Mixta, que supondría un proceso de dispersión reciente desde África, en una o varias oleadas, combinado en algunos casos, con una mezcla entre especies o subespecies.



Paleontología Humana (Paleoantropología)
Leer más

La controversia sobre Homo rudolfensis


Homo rudolfensis es una especie de hominido fósil, que habitó en el este de África en el Pleistoceno inferior hace 1,9-2,4 millones de años. La asignación de la especie suscita una gran controversia. Fue propuesta por Valerii P. Alexeev en 1986, en base a un espécimen tipo, denominado KNM-ER 1470, hallado en Koobi Fora, en Kenia, en la orilla oriental del Lago Turkana, por Bernard Ngeneo, un miembro de equipo de Richard Leakey, en 1972.

El cráneo KNM-ER 1470 carece de cresta craneal, la bóveda craneal es más grande y menos robusta que la de los australopitecos, el rostro es prominente y robusto. Aunque inicialmente se le estimó una capacidad craneal de 750 cc, grande para un Homo habilis, una reconstrucción por ordenador realizada en 2007 determinó que el cráneo no se había reconstruido de forma adecuada y redujo su volumen a 575 cc, que estaría dentro del rango de Homo habilis.

El maxilar es cuadrado, con un paladar plano y muy corto, con gran anchura, que contrasta con la de los australopitecos. La dentición postcanina es bastante grande, con grandes coronas y raíces más complejas que en Homo habilis, con el último molar más grande que el segundo. Grandes alveolos sugieren potentes caninos e incisivos.

Los escasísimos materiales poscraneales indicarían una bipedación más lograda que la de Homo habilis

Réplica del cráneo KNM-ER 1470

Réplica del cráneo KNM-ER 1470

La asignación a una especie del cráneo KNM-ER-1470

Alexeev lo designó en 1986 como Pithecanthropus rudolfensis, aunque posteriormente se ha adscrito tanto a los géneros Homo como Australopithecus.

La opinión predominante en la actualidad es que el cráneo pertenece a la especie Homo habilis, pero no obstante posee unas marcadas diferencias morfológicas, como son la forma de la cara, que es más plana, larga e inclinada hacia delante; las medidas craneales en su conjunto (un 45% de las medidas que se compararon entre las dos especies superan el dimorfismo sexual de los gorilas) y el volumen craneal, que aunque en un principio se estimaba bastante superior el del cráneo, un estudio posterior les calcula similares; y unos dientes post-caninos más amplios y con raíces y coronas más complejas y esmalte más grueso.

Algunos autores han propuesto que se defina un nuevo género para esta especie en el que se incluya también a Homo habilis.

El Homo rudolfensis habitó en un periodo de tiempo comprendido entre 1,78 y 2,4 millones de años en el este de África, por lo que posiblemente hubo al menos tres especies de Homo en un espacio temporal en la misma zona de 1,78 millones a 2,03 millones de año, Homo habilis, Homo rudolfensis y Homo ergaster, así como de otros homínidos, como el Paranthropus boisei. Su área de dispersión parece haber sido exclusivamente el este africano, por lo que muchos paleoantropólogos lo consideran un endemismo.

El hecho de la coexistencia de tres especies inteligentes en África suscita un interesante debate. Parece clara la asociación de Homo habilis con las industrias líticas de Olduvai y de Homo rudolfensis con las del lago Turkana.

Esta coexistencia ha dado argumentos para sostener la hipótesis de que Homo ergaster descendería de Homo rudolfensis. Para otros expertos, Homo ergaster y Homo rudolfensis fueron especies hermanas descendientes de otra que vivió en África, hace 2-3 millones de años.



Paleontología Humana (Paleoantropología)
Leer más

La teoría del tejido costoso

Cerebro humano
En 1891, el antropólogo y anatomista Sir Arthur Keith había observado que en los primates existe una relación inversa entre el tamaño del aparato digestivo y el tamaño del cerebro. En 1995, los antropólogos Leslie Aiello y Peter Wheeler para dar una explicación a este hecho crearon la teoría del tejido costoso.

Esta teoría sostiene que el cerebro es uno de los órganos más costosos en el metabolismo, es decir, uno de los que consume más energía. Aunque sólo supone un 2 % del peso total, consume un 20 % de la energía en reposo. De esta manera, su aumento de volumen requerirá una reducción de otro órgano que consuma energía.

En los humanos, los órganos energéticamente más costosos son el corazón, los riñones , el cerebro y el sistema digestivo, formado este por el tubo digestivo más el hígado. La tasa metabólica basal del organismo es el gasto energético por unidad de tiempo, necesario para mantener las funciones vitales de un individuo en reposo. El cerebro supone el 16 por ciento de esta y el tubo digestivo, un porcentaje próximo, el 15 por ciento. El índice de encefalización, que corresponde a grosso modo al tamaño del cerebro, en el ser humano es bastante superior que el que correspondería a un primate de nuestro tamaño, y en la misma proporción, el tubo digestivo humano es menor que lo que le correspondería.

Por estas razones, la expansión cerebral en el género Homo fue posible por un acortamiento del tubo digestivo. La longitud de este depende del tipo de alimentación. En los carnívoros es menor que en los herbívoros porque la carne es más fácil de asimilar que los alimentos vegetales ricos en celulosa.

Hace unos 2,5 millones de años se produjo un cambio climático con un enfriamiento general del planeta. En el Este de África, las formaciones herbáceas y sabanas se expandieron, mientras que la superficie de selva disminuyó. Esto va a promover cambios evolutivos en los homínidos.

Uno de ellos será el que tomen los parantropos o australopitecinos robustos, una especialización de su aparato masticador para alimentarse de los vegetales duros, aunque nutritivos, de la sabana. Su cerebro no experimentará el mismo desarrollo que el los Homo. Estos, en cambio, optarán por consumir productos de más fácil asimilación y poder calorífico, como grasas y proteínas animales, al principio como carroñeros y más tarde como cazadores.

Este cambio en la dieta debería haberse traducido en una adaptación de la morfología dental que no se produce ¿por qué? La explicación estaría en que Homo usa herramientas externas, extracorporéas, para facilitar su alimentación, consistentes en cantos y piedras talladas.

Aiello y Wheeler afirman que todo esto no quiere decir que el cambio de dieta produjera automáticamente un aumento del tamaño del cerebro, pero que el hacerse carnívoros para el desarrollo del cerebro y la inteligencia fue un paso necesario.

Otro aspecto importante, aunque no está clara su aparición sería el uso del fuego, ya que sería un elemento esencial para poder sobrevivir en la sabana abierta, ya que habría permitido mantener alejados a muchos depredadores nocturnos, sustituyendo así al refugio que proporcionaban los árboles.

Mientras los Homo se expandieron y desarrollaron, los parantropos o australopitecinos robustos desaparecieron hace 1 millón de años. Posiblemente su nicho ecológico se fue reduciendo, con la competencia de papiones y geladas y también de nuestros antepasados humanos.

La agricultura, actividad humana destinada a la alimentación y que surge en el cuatro milenio antes de Cristo, se sustenta en gran medida en productos vegetales, en cierto modo, no muy distintos de los que consumían los parantropos. Sin embargo, hay una gran diferencia, ya que las duras semillas de cereales y leguminosas no las comemos crudas, sino procesadas (harina, pan) o cocidas, y los frutos con cáscara no los partimos con los dientes, sino con herramientas. No era volver a la dieta de los parantropos, sino tener la posibilidad de la alimentación asegurada.

Esta teoría ha sido cuestionada por investigadores de la Universidad de Zurich. Estos investigadores, a través del estudio de numerosos especímenes de zoológicos y museos, han llegado a la conclusión de que los mamíferos con cerebros relativamente grandes, en realidad, tienden a tener un tracto digestivo algo más grande. Entrarían a formar parte del desarrollo del cerebro otros factores, como el incremento de la cantidad de energía por un aumento de la calidad de la dieta, al incorporar grasas y proteínas naturales, y optimizar la energía disponible reduciendo los gastos energéticos de locomoción por bipedalismo y los de reproducción, aumentando la longevidad y alargando el periodo del desarrollo.


Temas de Paleontología Humana (Paleoantropología)
Leer más

Paranthropus boisei


El Paranthropus boisei fue descubierto en 1959 por la antropóloga  Mary Leakey en Olduvai, Tanzania. Inicialmente, la especie fue nominada como Zinjanthropus boisei. La especie fue adscrita al género Paranthropus por Robinson en 1960, y posteriormente al género Australopithecus, como Australopithecus boisei, por Leakey y sus colaboradores en 1964, sin embargo ha prevalecido la adscripción de Robinson, con el nombre de Paranthropus boisei. Sigue existiendo discusión entre los especialistas sobre el género al que pertenece esta especie.

Sus fósiles aparecen en sedimentos del Pleistoceno inferior, de hace 1,3 a 2,3 millones de años. El primer ejemplar descubierto por Mary Leakey tenía 1,75 millones de años.


Características anatómicas

Paranthropus boisei vivió en un entorno seco, alimentándose de vegetales duros, por lo que desarrolló un potente aparato masticador destinado a triturar semillas y raíces.

Su capacidad craneal era de alrededor de 515 centímetros cúbicos. Tenía la cara muy ancha y redondeada, con unos incisivos muy pequeños, pero unos enormes molares y una cresta sagital a la que debían unirse unos grandes músculos masticadores. Su foramen magnum está más adelantado que en Australopithecus.

Cráneo de Paranthropus boisei

Cráneo de Paranthropus boisei
Su peso, estatura y aspecto general es muy parecido a los otros Australopithecus. Hallazgos de restos parciales del esqueleto postcraneal muestran unas características muy robustas, como unos brazos largos y fuertes con huesos muy robustos. Los machos pesaban en promedio de 49 a 62 kg, según diferentes cálculos, y las hembras unos 34 kg, reflejando un claro dimorfismo sexual. Es posible que formaran comunidades de varios machos emparentados, en las que cada uno agruparía un pequeño harén de hembras. La altura mínima era de unos 1,56 m.


Hábitat

En Etiopía, durante el espacio de tiempo en que vivió esta especie, el clima se hizo más árido, disminuyendo las precipitaciones, aunque el bosque probablemente persistió alrededor de los cursos de agua, de donde salieron los depósitos fosilíferos. La aparición de esta especie no coincide con un cambio climático, como en Sudáfrica. Durante el espacio de tiempo en que vivió esta especie, no sufrió cambios anatómicos sustanciales, pese a los grandes cambios climáticos de su época. Paranthropus boisei vivía en las zonas llanas de África Oriental, donde los bosques habían desaparecido, siendo reemplazados por sabanas y llanuras extensas, así como valles fluviales donde se concentraba gran cantidad de vida terrestre y semiacuática.

Paranthropus boisei vivió en un medio ambiente más seco que sus ancestros Australopithecus. Ante el cambio climático hacia una mayor aridez, las especies de éste género recurrieron a la especialización de su aparato masticador para poder sobrevivir en un medio más seco. Así, con unas poderosas mandíbulas pudo tener acceso a raíces, tallos gruesos, etc. En cambio, el resto de su estructura corporal no varió prácticamente nada con respecto a sus antecesores Australopithecus.

La especialización alimentaria ante este cambio climático se vio demostrada de otra forma con el descubrimiento de un cráneo con mandíbula completo, en 1997, en Konso (Etiopía). En ese mismo yacimiento se encontraron muchos huesos de bóvidos alcelafinos, familia que comprende los ñus, topis, que se sabe que se alimentan de plantas del tipo C4, propias de matorrales de clima seco y semi seco. Por tanto, se sabe que el hábitat de los Paranthropus boisei vivieron era la sabana.

Reconstrucción de Paranthropus boisei

Reconstrucción de Paranthropus boisei

Convivencia con Homo

Paranthropus boisei, convivió con los Homo durante 1,5 millones de años, compartiendo su hábitat con otros tres homininos: Homo habilis, Homo rudolfensis y Homo erectus. A diferencia de estos, Paranthropus boisei tenía una dieta más herbívora, mientras que los otros eran más oportunistas: comían carne y alimentos con proteínas, lo que les permitió desarrollar más la inteligencia, haciendo un uso mayor de herramientas. Sin embargo, Paranthropus boisei también comía termitas y hormigas, usando un palito como herramienta, como lo hacen los actuales chimpances.

Al no estar en la cima de la cadena alimenticia era vulnerable al ataque de los depredadores. Un depredador que sobresalió en su época fue Crocodylus anthropophagus, un cocodrilo conocido por haber atacado a homínidos, que les acechaba bajo el agua cuando se acercaban a beber. Otros, como leopardos y otros grandes felinos, los perseguían ocultos bajo la maleza, y estos, al no tener la suficiente velocidad para escapar, caían víctimas de estos depredadores.



Paleontología Humana (Paleoantropología)
Leer más

Los australopitecos robustos


Las características de estas especies se basan en primer lugar por una capacidad endocraneana entre 500 y 530 centímetros cúbicos (la media se sitúa en 520 cm3), la mayor entre los australopitecos. Sus rasgos presentan una clara robustez, de lo que deriva su nombre especifico. Sus incisivos y caninos son pequeños y se presenta una mayor expansión de premolares y molares. Los arcos cigomáticos muestran unos pómulos amplios y unas grandes mandíbulas.

La mayoría presenta una cresta sagital pronunciada, que unida a los otros caracteres ha llevado a considerar una gran adaptación masticatoria, especializada en aplicar una mayor fuerza vertical en la masticación. Para algunos autores la degradación que presentan en el esmalte dental viene de elementos abrasivos (posiblemente tierra), durante la masticación de plantas y bulbos subterráneos. Para otros, el desgaste de las piezas dentarias radica en una dieta más rica en vegetales fibrosos que la que poseía el Australopithecus africanus. Dadas estas interpretaciones sobre su comportamiento, al Zinjanthropus se le denominó "cascanueces".

El surgimiento de estas especies está asociado a un ambiente más árido, con plantas más fibrosas y duras, que incluirían bulbos subterráneos.

Habrían vivido hace 1,1-2,6 millones de años. Para algunos paleontólogos los australopitecinos robustos pertenecen a Australopithecus, pero la mayoría coinciden en que tienen características propias y definidas.

Los restos postcraneales descubiertos del Australopithecus robustus presentan similitudes con el Australopithecus africanus, si bien era algo más grande, ya que su peso se ha estimado entre 46 y 62 kilos y una altura media entre 1,5 y 1,6 metros. Puede haber debates sobre la filogenia del australopiteco en relación con el Homo, pero hoy nadie pone en duda que el Australopithecus robustus y el Australopithecus boisei están fuera de esta línea, extinguiéndose hace 700.000 años y calculándose su aparición hace aproximadamente 2 millones de años.

Su mayor capacidad cerebral ha sugerido la posibilidad del uso de herramientas. El único tipo de herramientas usadas serían fragmentos de hueso y cuernos, como los encontrados en Swatrkrans, que se hallan desgastados de la misma forma en que se desgastarían si hubieran sido usados para excavar. Pero en todo caso, no es una evidencia firme.

Se consideran una separación de la línea que conduciría a Homo. Reforzada esta tesis por el descubrimiento de Australopithecus garhi, especie de homínido extinguido que habitó en la zona de la actual Etiopía hace unos 2,5 millones de años, en el Pleistoceno inferior y descubierto en 1996. y que inicialmente se creyó que era el eslabón perdido entre los géneros Australopithecus y Homo, y por lo tanto un ancestro de nuestra especie. Sin embargo Australopithecus garhi es más avanzado que cualquier otro australopiteco, y una especie posiblemente contemporánea de las especies ancestrales de Homo, por lo tanto no es probable que sea un ancestro humano. Por tanto existirían tres líneas, una de la Australopithecus garhi, otra la de los australopitecos robustos y otra la que daría lugar a Homo.

Inicialmente se les encuadró en el género Zinjanthropus, posterioremente Robinson les denominó Paranthropus y más tarde, tras el descubrimiento de Mary Leakey como Australopithecus. Hoy día, hay discusión entre si pertenecen al género Australopithecus o a otro distinto, Paranthropus, pero predomina la denominación del género Paranthropus, del que se han descrito tres especies:

 -Paranthropus aethiopicus. Es la primera que aparece hace 2,5 millones de años. Habitó en África Oriental. De rostro macizo, con prominente cresta sagital, posiblemente dio origen a las otras dos especies.

Paranthropus boisei. Tenía una apariencia todavía más robusta, con características craneales están especializadas para el consumo de vegetales duros. Gran dimorfismo sexual, siendo mucho más grande el cuerpo del macho que de la hembra. Situado entre 2,3 y 1,2 m.a. Habitó en África Oriental hace 1,2-2,3 millones de años.

Paranthropus robustus. De huesos especialmente gruesos, rostro alto y alargado. con piezas dentarias macizas. Vivió en Sudáfrica hace 1,5-1,8 millones de años. Coexistió con los Homo un millón de años, hasta que se extinguió.



Paleontología Humana (Paleoantropología)
Leer más

El uso de herramientas por los australopecinos

Familia de Australopithecus

Tras la investigación del equipo dirigido por Shannon P. Mcpherron, del Instituto Max Planck de Alemania, y Zeresenay  Alemseged, de la Academia de Ciencias de San Francisco, estudiando una costilla de un mamífero del tamaño de una vaca y el fémur de un antílope mediante microscopía electrónica y espectrografía, se llegó a la conclusión de que el Australopithecus afarensis ya utilizaba herramientas, en concreto piedras afiladas para sacar la carne de los huesos, triturándolos para alcanzar el tuétano, de un alto valor nutritivo.

La incógnita es si eran capaces de fabricarlas, dado que en el lugar que aparecieron, con sedimentos volcánicos, no había piedras para hacer esos cortes, por lo que se cree que las debieron traer de otros lugares, a varios kilómetros de distancia.

Esto adelantaría casi un millón de años la capacidad de nuestros ancestros del uso de herramientas, ya que hasta entonces se consideraba que las primeras herramientas databan de unos 2,5-2,6 millones de años, atribuyéndose al Homo habilis, de ahí su nombre, cuya capacidad craneal es un 40 % superior a los Australopithecus.

El descubrimiento adelantaría no sólo la capacidad manual de crear herramientas, sino el consumo de carne de grandes animales, relacionado con el aumento del tamaño del cerebro, que hasta entonces se había considerado que surgiría un millón de años después.

No obstante, esta tesis tiene numerosos detractores, entre varias, la del arqueólogo español Manuel Domínguez-Rodrigo, director del proyecto español paleoantropológico en Olduvai (Tanzania), que afirma en un estudio que las marcas en los huesos se hicieron al ser pisoteados por los animales en un suelo de grava, no en una actividad de consumo de carne. Según este investigador, los trozos encajan perfectamente con otros huesos pisoteados y el error pudo deberse a que los huesos no fueron analizados por un experto en tafonomía, que se habría percatado de las diminutas estrías típicas de los pisoteos aleatorios. También afirma que teóricamente no hay razones para negar, a priori, la hipótesis de que el Australopithecus afarensis utilizara herramientas como cuchillo, pero no se pueden utilizar como prueba estos fósiles.

El debate se ha avivado tras el descubrimiento anatómico en Australopithecus sediba de una muñeca funcional para la fabricación de herramientas.



Paleontología Humana (Paleoantropología)
Leer más

Práctica 10. Análisis de estudios genéticos


La genética es la ciencia que estudia la herencia biológica transmitida de generación en generación y  la genómica es el conjunto de ciencias y técnicas dedicadas al estudio integral del funcionamiento, el contenido, la evolución y el origen de los genomas. Ambas.proporcionan una gran cantidad de datos valiosos desde el punto de vista evolutivo. Los datos genéticos y genómicos están desempeñando un papel cada vez más importante en los debates de antropología biológica, no sólo en los temas de la evolución humana. Esta práctica de laboratorio nos ayudará a conocer algunas de las maneras en que se usan los datos genéticos para entender nuestro pasado evolutivo.


1. Secuenciación de ADN

La secuenciación de ADN es un conjunto de métodos y técnicas bioquímicas cuya finalidad es la determinación del orden de los nucleótidos (A, C, G y T) en un oligonucleótido de ADN.

Secuenciación de ADN

La evolución es un cambio heredable en una población a través del tiempo. A partir de los datos genéticos podemos saber más de los cambios evolutivos en nuestro pasado. Existen fuerzas evolutivas específicas. La mutación crea nueva variación de manera aleatoria, mientras que la deriva genética conduce a la pérdida de variación como una función del tamaño de la población.

También podemos conocer más sobre ancestros comunes. La variación dentro de los seres humanos hoy en día proviene de una variación común en el pasado.

Trabajando hacia atrás, por lo tanto, podemos tratar de descifrar algún grado de la historia de una población y de los eventos evolutivos que han dado forma al ver el modelo actual de la variación genética.

Los dos esquemas siguientes muestran un segmento de ADN:

Secuencias de ADN
Teniendo en cuenta lo anterior, ¿cuál de los segmentos de los posibles ancestros es muy probable que sea el ancestro común de los tres que comparten un ancestro común? Razonar la respuesta.


2. Diversidad de nuecleótidos

Ahora imaginemos, que estamos viendo las bases de nucleótidos que componen una cadena de ADN. Lo siguiente serían cuatro segmentos homólogos de ADN:

1 - AATAGCGGGCCATAGCCGGG

2 - AAAAGGGGGTCATAGCCGGG

3 - AATAGGGGGCCTTAGCCGGG

4 - AATTGCGGGCCATACCCGGG

Una medida básica de la diversidad genética (es decir, la variación) es la diversidad de nucleótidos. Este es el número promedio de las diferencias entre las dos hebras de ADN homóloga. Para calcular la diversidad de nucleótidos desea determinar cuántos existen diferencias por pares, y dividir por la cantidad que son teóricamente posibles. Aquí hay un ejemplo básico:

A - ATAGG

B - ACAGG

C - ATAGC

En este caso, tenemos tres personas, lo que significa que tenemos tres posibles comparaciones por parejas (AB, AC, BC).

El número de comparaciones por parejas posibles es igual a n (n-1) / 2 (donde n = número total de individuos). Además, estamos ante un segmento de 5 pares de bases. Así que el número máximo de posibles diferencias por pares es:

3 (comparaciones por pares) x 5 (longitud de la secuencia) = 15

El número total de las diferencias observadas es:

Entre A y B = 1, entre A y C = 1, y entre B y C = 2. Total = 4

 4 (pares de bases (2 entre A / B y B / C, y 5 entre A / C y B / C). Así, en este ejemplo, la diversidad de nucleótidos es 4/15, o 0,267. En otras palabras, en este (extremadamente) la comparación limitada, sobre 26-27% de pares de bases difieren individuo a individuo lado a otro, en promedio.

¿Cuál es la diversidad de nucleótidos para el ejemplo anterior (n = 4, pares de bases = 20).?


3. Diversidad genética y número de generaciones

Una diversidad de nucleótidos superior significa una mayor variación genética. La variación genética es el resultado de las fuerzas de la evolución: la deriva genética, el flujo de genes, la mutación y la selección natural.

En la acumulación de la variación genética, si la variación es neutral, y no está sujeta a la selección natural, la tasa global de la mutación es una variable crítica. La noción de "reloj molecular" nos dice que si sabemos cómo la variación rápida se está acumulando (es decir, la tasa de mutación), y sabemos lo variable que es un conjunto de ADN, entonces se puede estimar la cantidad de tiempo que habría tomado para generar la variación observada. En otras palabras, se puede estimar el tiempo que en el pasado la muestra dada probablemente compartió un antepasado común.

Consideremos de nuevo las secuencias anteriores de ADN:

1 - AATAGCGGGCCATAGCCGGG

2 - AAAAGGGGGTCATAGCCGGG

3 - AATAGGGGGCCTTAGCCGGG

4 - AATTGCGGGCCATACCCGGG

Una secuencia ancestral posible podría tener este aspecto:

A - AATAGCGGGCCATAGCCGGG

Para pasar de esta secuencia ancestral (A) a las cuatro anteriores (1,2,3,4) se requieren 7 cambios evolutivos (cuéntense).

En cada generación, cada par de bases tiene la probabilidad de experimentar de 1/10000. De esta manera, la tasa global de la mutación es igual a la tasa de mutación por pares de bases, multiplicada por el número de pares de bases de que se trate, pero también hay que recordar que cada individuo actúa de forma independiente, por lo que el número total de nuevas mutaciones producidas cada generación es igual a la tasa de mutación por pares de bases multiplicada por el número de pares de bases multiplicada por el número de individuos.

Si la probabilidad de que cualquier par de bases determinado que experimente una mutación de una generación a la siguiente es de 1 en 10 mil, ¿cuántas generaciones habrán de pasar para generar la diversidad genética en esta muestra?


4. Filogenia de Homo sapiens

El ADN mitocondrial o genoma mitocondrial (ADNmt) es el material genético de las mitocondrias, los orgánulos que generan energía para la célula, desciende de genomas circulares pertenecientes a bacterias, que fueron englobadas por un antiguo ancestro de las células eucarióticas. Se considera que el ADN mitocondrial humano se hereda sólo por vía materna.

La secuencia de ADN mitocondrial ancestral común para todos los seres humanos se remonta aproximadamente a unos 200.000 años atrás. Por otra parte, la población original de ADNmt humano era africano. Todos los seres humanos están igualmente relacionados entre sí.

Para entender por completo la historia genética completa de nuestra especie, tenemos que conocer no sólo una pequeña parte del genoma, sino más bien todo, o al menos una muestra grande y representativa. Esto significa conocer los 3,5 mil millones de pares de bases del material genético que se hallan en el núcleo de nuestras células.

En la década de 1990, los estudios genéticos y genómicos humanos mostraron una mayor variación en las poblaciones africanas. Sin embargo, algunos loci genéticos mostraron una historia diferente. Algunos sitios genéticos tuvo su mayor variación en las poblaciones no africanas y mostraron una mayor cantidad de variación de lo que cabría esperar en 200.000 años.

Si hubo un evento de especiación hace 200.000 años que dio origen al Homo sapiens, la evidencia de esto estaría preservada en todos los loci genéticos. ¿Cómo se puede explicar un exceso de variación genética con un origen más antiguo que lo que indicaría el modelo de especiación africana hace 200.000 años?

Una posibilidad sería que la población de Homo sapiens original no era una sola población, sino más bien un conjunto de poblaciones. Recordemos que la variación entre las poblaciones es una de las fuentes fundamentales de variación en una especie biológica. Si la especiación del Homo sapiens se dio por múltiples poblaciones, estas poblaciones habrían conservado mayor variación ancestral de lo que de otro modo se podría esperar, lo que explica las observaciones de muchas variantes genéticas antiguas.

Una forma de probar directamente la idea de que los seres humanos se cruzaron con las poblaciones arcaicas de Homo sería buscar directamente en el ADN extraído de esas poblaciones (llamado ADN "antiguo"). Los avances en la tecnología de secuenciación genética comenzaron a hacer esto posible en la década de 2000.

Los primeros estudios de ADN antiguo se centraron en el ADNmt, por las mismas razones que los primeros estudios de ADN humano se centraron en el ADNmt, por su facilidad de obtención. Estos estudios, basados ​​en ADN antiguo extraído de los neandertales, mostraron que el ADNmt neandertal era más divergente de los seres humanos que viven, en promedio, que las poblaciones humanas más divergentes. En otras palabras, los neandertales parecen ser más diferentes de los seres humanos actuales que las dos poblaciones humanas más diferentes que existan. Este resultado parece apoyar la tesis de que los neandertales se separaron de los seres humanos actuales en algún momento antes de nuestro origen. ¿Qué árbol filogenético representaría esta relación?

Hay que tener en cuenta que el ADNmt es apenas un solo locus genético, y no necesariamente una ventana a toda la historia de una especie, y el ADN nuclear no se hereda de forma fiable. El ADN nuclear y el ADN mitocondrial se heredan a través de diferentes procesos incompatibles entre sí.

Los neandertales y los homínidos de Denisova deberían mostrar más similitud con los europeos que otras poblaciones. Si los neandertales y los homínidos de Denisova eran una especie separada, deben ser igualmente relacionados con diferentes poblaciones humanas que viven.

Las recientes investigaciones del ADN de la Sima de los Huesos muestran desconcertantemente que el ADNmt de Atapuerca es más cercana a los denisovanos que a los nendertales. Una posibilidad es que el ADN mitocondrial no nos está contando una historia muy completa. Los denisovanos y los ejemplares de Atapuerca podrían estar más estrechamente relacionados en términos de ADNmt, pero los neandertales y los ejemplares de Atapuerca aún podrían estar más estrechamente relacionados en cuanto al ADN nuclear.

El patrón de la extinción de la población, la sustitución y el flujo de genes en la tarde del Pleistoceno fue compleja. Las poblaciones emigraron a través de toda Eurasia en un sentido y otro, y el movimiento de los genes y el movimiento de personas están estrechamente vinculados. Los denisovanos se extinguirían antes del origen de los neandertales.

Discutir, en base a lo anterior, el siguiente árbol filogenético de Homo, en el que la línea de cruce correspondería a los denisovanos:


Temas de Paleontología Humana (Paleoantropología)

Leer más

La evolución humana en la actualidad


Humanos

La evolución reciente de la especie humana

Estudios genómicos en los seres humanos han concluído que  la selección natural en la especie humana se ha acelerado en gran medida durante los últimos 40.000 años. Poblaciones más grandes generan más mutaciones y muestran la consistencia de los datos observados con el patrón histórico de crecimiento de la población humana. El crecimiento demográfico humano es fundamental para entender los cambios pasados ​​en las culturas humanas y en los ecosistemas. Ambos procesos han contribuido a la extraordinaria rapidez de la evolución genética reciente de nuestra especie.

Las poblaciones humanas han aumentado considerablemente en número durante los últimos 50.000 años e incluso desde antes. En teoría, más gente significa un mayor número de nuevas mutaciones adaptativas. Por lo tanto, el crecimiento de la población humana debería haber aumentado la tasa de sustituciones adaptativas: una aceleración de nuevos alelos seleccionados positivamente.

¿Puede esta idea realmente describir la evolución humana reciente? Hay varias cuestiones posibles. Sólo una pequeña fracción de todas las mutaciones son ventajosas, la mayoría son neutrales o perjudiciales. Por otra parte, si una población se hace más adaptada a su entorno actual, las nuevas mutaciones deberían ser menos y menos probable que aumente su aptitud. Debido a que las especies con grandes tamaños de las poblaciones llegan a un pico de adaptación, su tasa de evolución adaptativa con el tiempo geológico no debe exceder en gran medida la de las especies raras.

Pero los seres humanos están en un momento transitorio excepcional desde el punto de vista demográfico y ecológico. El rápido crecimiento de la población se ha producido, junto con grandes cambios en la cultura y en los ecosistemas durante el Pleistoceno tardío y el Holoceno, trayendo consigo la creación de nuevas oportunidades para la adaptación. En los últimos 10.000 años se ha producido una rápida evolución esquelética y dental en la población humana y la aparición de muchas nuevas respuestas genéticas a dietas y enfermedades.

En una población de gran tamaño, transitoria, el tamaño aumenta la velocidad y la eficacia de las respuestas de adaptación. Por ejemplo, las poblaciones naturales de insectos a menudo adquieren resistencia monogénica efectiva a los pesticidas, mientras que las pequeñas poblaciones de laboratorio en virtud de selección similar desarrollan adaptaciones poligénicas menos eficaces. Experimentos en Escherichia coli muestran una respuesta continua a la selección, con respuestas continuas y repetibles en grandes poblaciones, pero respuestas variables y episódicas en poblaciones pequeñas. Estos resultados se explican por un modelo en el que el tamaño poblacional pequeño limita la tasa de evolución adaptativa. Una población que aumenta de repente en tamaño tiene un potencial de adaptación rápida. La mejor analogía a la reciente evolución humana puede ser la rápida evolución de los vegetales domesticados tales como el maíz.

La variación genética humana parece consistente con una aceleración reciente de la selección positiva. Una nueva mutación ventajosa que escapa a la deriva genética aumentará rápidamente su frecuencia. Estudios genéticos muestran una tasa excepcionalmente rápida de la evolución adaptativa.

La capacidad de digerir la lactosa puede ser un ejemplo de la evolución adaptativa en el linaje humano. La selección natural positiva o la tendencia de los rasgos beneficiosos para aumentar la prevalencia (frecuencia) en una población es la fuerza impulsora de la adaptación y la evolución. Para que un rasgo sea de selección positiva debe tener dos características. En primer lugar, la característica debe ser beneficiosa, o lo que es lo mismo, debe aumentar en el organismo la probabilidad de sobrevivir y reproducirse. En segundo lugar, el rasgo debe ser heredable de modo que se puede pasar a la descendencia. Los rasgos beneficiosos son extremadamente variados y pueden incluir coloración protectora, una capacidad de utilizar una nueva fuente de alimento, o un cambio en el tamaño o la forma que pueda ser útil en un determinado medio ambiente . Si una característica se traduce en más crías que comparten el rasgo, entonces es más probable que se convierta común en la población de un rasgo que surge al azar. A nivel molecular, la selección se produce cuando un determinado ADN variante se vuelve más común debido a su efecto sobre los organismos que llevan.

Charles Darwin y Alfred Wallace (1858) propusieron que la selección positiva podría explicar las muchas adaptaciones de los organismos a su medio ambiente, y este simple proceso sigue siendo la explicación central para toda la adaptación evolutiva hoy en día. No obstante, la selección positiva de ninguna manera es el único componente de la evolución. En los seres humanos, al menos, la gran mayoría de las mutaciones se cree que son selectivamente neutras, que no confieren beneficios, ni perjuicios a sus portadores. La frecuencia de algunas de estas variantes genéticas neutras (alelos) aumentan simplemente por casualidad. Se piensa que la deriva genética es el proceso más común en la evolución humana. Por otra parte, cuando la selección ocurre, es más a menudo en forma negativa o subsanadora, como selección que elimina las nuevas mutaciones perjudiciales que puedan surgir, en lugar de promover la difusión de nuevas características.

El barrido selectivo (en inglés, selective sweep) es la eliminación o reducción de la variabilidad genética entre los nucleótidos vecinos a una mutación como resultado de un proceso reciente y positivo de selección natural. Esto puede ocurrir cuando se produce una mutación que incrementa la eficacia biológica de un organismo en relación a sus semejantes de la misma población. La selección natural favorecerá a aquellos individuos con mayor aptitud y, tras varias generaciones, el nuevo alelo mutante incrementará su frecuencia en la población. Al mismo tiempo, todos los genes neutrales o casi meutrales que se hallan ligados a la nueva mutación también incrementarán su frecuencia en la población.

En virtud de la selección natural, una nueva mutación beneficiosa aumentará en su frecuencia (prevalencia) en una población.


Pruebas de selección positiva en los humanos

En la última década, nuestra capacidad de estudiar en profundidad la evolución de la especie humana ha aumentado enormememente debido a la avalancha de datos genéticos que se han generado. La secuencia completa del genoma del ser humano proporciona un marco de referencia y estándar para todos los estudios de genética humana. Los conjuntos de datos principales incluyen los genomas completos o casi completos de varias especies relacionadas (por ejemplo, el chimpancé, el macaco, el gorila, y el orangután). También existe una base de datos pública de las variantes genéticas conocidas en los seres humanos y estudios de variación genética de cientos de personas en varias poblaciones. Con estos nuevos datos, ahora es posible explorar todo el genoma humano en busca de señales de selección natural .

Aunque el estudio de la selección natural en el ser humano se encuentra todavía en una etapa temprana, los nuevos datos, basándose en décadas de trabajo anterior, están comenzando a revelar algunos aspectos importantes de la selección en nuestra especie. De hecho, los investigadores han identificado muchos loci genéticos en los que probablemente se ha producido la selección, y se han aclarado algunas de las presiones selectivas que intervienen. Tres fuerzas significativas que se han identificado hasta el momento incluyen cambios en la dieta, los cambios en el clima y las enfermedades infecciosas .


Tolerancia a la lactosa

La domesticación de plantas y animales hace unos 10.000 años cambió profundamente la dieta humana, y los individuos que mejor digerían los nuevos alimentos adquirían una ventaja selectiva. La capacidad de digerir la lactosa, un azúcar que se encuentra en la leche, por lo general desaparece antes de la edad adulta en los mamíferos, y esto es cierto en la mayoría de las poblaciones humanas. Sin embargo, para algunas personas, entre ellas una gran parte de las personas de ascendencia europea, la capacidad de digerir la lactosa persiste debido a una mutación en el gen de la lactasa. Esto indica que el alelo se hizo común en Europa a causa de una mayor nutrición de la leche de vaca, que llegó a estar disponible después de la domesticación del ganado. Esta hipótesis fue confirmada posteriormente por Todd Bersaglieri y sus colegas, quienes demostraron que el alelo persistencia de la lactasa es común en los europeos (casi el 80% de las personas de ascendencia europea llevan este alelo), y tiene evidencia de un barrido selectivo que abarca más o menos 1 millón de base pares (1 megabase). De hecho, la tolerancia a la lactosa es una de las señales más fuertes de selección en el genoma. Sarah Tishkoff y sus colegas encontraron posteriormente una mutación distinta, que también confiere tolerancia a la lactosa, en este caso en las poblaciones de pastores africanos, lo que sugiere la acción de evolución convergente.


Resistencia  a la malaria

El desarrollo de la agricultura también cambió las presiones selectivas sobre los seres humanos de otra manera. Se dio un aumento de la densidad de población que hizo que la transmisión de las enfermedades infecciosas fuera más fácil, y es probable que se expandió el papel ya considerable de agentes patógenos como agentes de la selección natural. Ese papel se refleja en las huellas dejadas por la selección en la diversidad genética humana. Múltiples loci asociados con la resistencia a la enfermedad han sido identificados como sitios probables de selección. En la mayoría de los casos, la resistencia es la misma enfermedad de la malaria.

El poder de la malaria para conducir la selección no es de extrañar, ya que es una de las enfermedades más antiguas de la población humana y sigue siendo una de las mayores causas de morbilidad y mortalidad en el mundo de hoy, infectando cientos de millones de personas y matando a 2.000.000 niños en África cada año. De hecho, la malaria fue responsable del primer caso de la selección positiva demostrada genéticamente en los seres humanos. En los años 1940 y 1950, Haldane y Allison demostraron que la distribución geográfica de la mutación de células falciformes en el gen de la hemoglobina beta se limita a África y se correlacionó con la endemicidad de la malaria. Desde entonces, muchos más alelos de resistencia a la malaria han mostrado pruebas de la selección.


Pigmentación

Cuando los proto-europeos y los asiáticos se trasladaron hacia el norte de África, pasaron a un entorno de menos luz solar y temperatura más fría, nuevas fuerzas ambientales que ejercen una presión selectiva sobre los emigrantes. Exactamente por qué la luz solar reducida debería ser una fuerza potente y selectiva es algo todavía debatido, pero ha quedado claro que los seres humanos han experimentado la selección positiva en numerosos genes para un ajuste fino de la cantidad de pigmento de la piel que producen, dependiendo de la cantidad de exposición a la luz solar.

El papel de la selección en el control de la pigmentación humana no es una idea nueva, de hecho, se avanzó primero por William Wells en 1813, mucho antes de la formulación de Darwin de la selección natural. En los últimos años, las señales de selección positiva se han identificado en muchos genes, con algunas señales únicamente en los europeos, algunas exclusivamente en los asiáticos, y algunas compartidos a través de dos continentes. La evidencia para la depuración de selección también se ha encontrado al mantenerse el color de la piel oscura de África, donde la exposición al sol es grande.

Un buen ejemplo de la selección de la pigmentación más clara es el gen SLC24A5, que fue uno de los primeros en ser caracterizado. Rebecca Lamason y sus colegas identificaron una mutación en el pez cebra homólogo de este gen que es responsable de la pigmentación del fenotipo. El equipo de investigadores demostraron que una variante humana del gen explica aproximadamente un tercio de la variación en la pigmentación entre los europeos y los africanos occidentales, y que la variante europea había sido probablemente un objetivo de la selección. En un trabajo relacionado, Angela Hancock y sus colegas examinaron muchos genes implicados en el metabolismo, demostrándose que los alelos de estos genes muestran evidencia de selección positiva y se relacionan estrechamente con el clima, lo que sugiere que los seres humanos se adaptaron a climas más fríos, cambiando sus tasas metabólicas.


Estudios de selección natural en seres humanos

La comprensión de los mecanismos biológicos en estos casos y en muchos otros como ellos, no será fácil, y requerirá aportaciones de diversos campos, incluyendo la genética, biología molecular, biología del desarrollo, y el estudio de modelos de organismos. Sin embargo, las recompensas potenciales son altas. A través del estudio de la selección natural en los seres humanos, los investigadores esperan aprender más acerca de cómo nuestra especie ha cambiado con el tiempo, de los desafíos que la especie se ha enfrentado y cómo los ha superado, y conocer más de las causas pasadas y presentes de las enfermedades.



Paleontología Humana (Paleoantrapología)
Leer más